NIKILAB > Protocols > 2D gel in pombe　　　　　　　　　　　　　　　　　　

Neutral-neutral DNA 2D gels (for replication intermediate) 　　　　　　　　　　　　　　　　　by Kanji Furuya
The protocol is modified from B .Arcangioli lab protocol. I have tried glass beads methods and CTAB methods. But this one seems to be the best. The DNA from glass beads methods sometimes run differently from tme to time probably because of the sheared DNA product. CTAB methods (Lopes et al., 2003 mol. cell) is not suitable for S.pombe because of the disturbing sugar precipitates which behaves exactly same as DNA in CTAB solution.

The replication intermediates devoid of chromatin proteins are very fragile. They are sensitive in mixing. I think B .Arcangioli lab protocol is suitable as it allows us to mix the naked DNA gently in small tubes, while using the other protocols we need to mix in larger volumes which force more stress during final ethanol precipitation step.

As for the probe, if you want to see the origin regions and regions nearby, it is better to see ARS2004. The HaeIII digest will give 3kb fragments from origin region and 5kb, and 16kb away as well. However, the origin is not efficient enough to see the signal in HU treated cells. In that case, I would recommend to use ARS2-1 instead (J.Huberman).

DNA extraction step
Day 1

  1. Harvest 250ml of OD 0.5 (5x106) culture. Mix immediately with iced EDTA (pH8 200mM 50ml stored in centrifuge bottles) 2.5mL 10% NaN3. This will be for 10 plugs.
  2. centrifuge for 5minutes in SLA-3000, 4,500rpm at 4C
  3. Wash with 25mL TE 25x (10mM Tris 7.5, 25mM EDTA) at 4C. Transfer the cells to 50mL tubes and spin at 4000rpm 3minutes.
  4. Wash with 10 mL SP1 buffer at 4C. (I usually re-suspend cells using loops. Freezing down the cell pellete is no problem, and actually freezing process makes signals better later somehow. It may kill endogenous nucleases)
  5. Re-suspend cell pellete in 2.5mL SP1 at 4C (with loops). Add 0.5mL of Lyticase buffer and mix well (gently inverting) shift temperature to 37C and incubate for 15 minutes. Mix occasionally. Check the lysis by 1% SDS.
  6. Spin at 2000rpm 3minutes and remove supernatant completely.
  7. Resuspend cells in 300 micro L of SP1 using loops (gently.)
  8. Add Low Melt agarose (1% at 42 C) 400micro L. Mix carefully by cut Blue tips. Pippete for 5 times. Pour into the mould using cut yellow tips.
  9. leave mould on 4C for 5minutes.
  10. Remove agarose plugs from the mould using extruder (supplied together with  the mould) into 50 mL tube. Incubate with 10mL of DB buffer. 30 minutes at 50 C.
  11. Change the DB solution and and leave for another 30 minutes at 50 C.
  12. Change the solution again and leave O/N.

Day 2

  1. Remove DB and add 50mL TE 50x (10mM Tris 7.5, 50mM EDTA) 3hours at 4C (light agitation).
  2. Change TE 50x and 4C over night (light agitation). You can keep up  to 4 days at 4C.

Day3

  1. Wash plugs by TE 1x 50ml at 4 C 45minutes 3times by changing the TE. (for 1 run 5 plugs would be enough).
  2. Cut the plugs in 2 halves (with cover slips), transfer them into 2mL tubes (5plugs /tube)
  3. Wash the cut plugs in TE for 30 minutes.
  4. Wash the cut plugs in 2x restriction enzyme buffer at 4C for 30 minutes. (For the enzymes to use, see below)
  5. Reapeat step 4 with 1x restriction buffer
  6. Add a mix containing the restriction enzyme in 1x restriction buffer (40U/100ml/plug, For the amount to use, see NEB catalog))
  7. After 2hrs of digestion, melt agarose 10 minutes 70C, mix gently occasionally. Leave the tube at the enzyme digestion temperature, add 40U enzyme/plug and incubate for another hour.
  8. Add b-AgaraseI (NEB M0392, 2mL/plug), RNase (DNase free 500mg/mL, 2mL/plug) 1hour 37C.
  9. Centrifuge 1minute 13,000rpm.
  10.  Collect supernatant slowly using cut blue tips into 2ml eppendorf (2-3 tubes).
  11. Precipitate with 0.7 volume of isopropanol. Do not forget to add 0.1 volume of 3M NaOAC. (Leave over night in 4C) If you have a sample in several separate tubes, I would spin one of them first, decant away the supernatant, and pouring the next one over  onto the DNA pellete. Basically, you have to avoid to end up the DNA from one sample in several tubes. You do not want to collect them from each tube and put them together. It will definitely shear your replication intermediate when you pipette out the DNA from each tubes.
  12. Resuspend in 20 mL of TE. Do very gently, and never pipette. Dissolve DNA by taping with the finger. Run 1 mL for the test in small gel to see the digestion. If the digestion is not enough, digest another hour using 10 mL of enzyme in 150 mL.

Buffers

SP1 (1.2M Sorbitol, 50mM Citrate Phosphate, 40mMEDTA(pH8), final pH 5.6.
For 500mL
250mL 2.4M Sorbitol
70mL 0.5M Na2HPO4
55mL 0.2MCitric acid

Low Melt agarose (1%) in SP1
Melt 5minutes in 95C, well vortex. Equilibrate in 42C at least 15 minutes before the experiment.

Lyticase (200U/mg L4025 Sigma, we stopped using Zymolyase as the lyticase is 5 times cheaper than it)
Stock solution 3.5mg/mL

DB (digestion buffer)
1% Lauryl sarcosine (Sigma)
1mg/ml ProteinaseK (Sigma)
25mM EDTA pH8

Selection of the enzymes

Single copy ARS (ARS 2004)
HaeIII
3kb fragment
Using this enzyme, flanking sequence (5kb, 16kb away from origin is also visible by reprobing one membrane see figurex)

Probe for ARS2004
PCR forward  tctattggtataaccaattcc
PCR reverse ACGCTGAGTAATTAGCAATG

Probe for 5kb
    PCR forward taaaatgataaacctgaaacg
PCR reverse gcgaactttgagtctatacg
Probe for 16kb
    PCR forward gttcttgtttattaaattgcgc
    PCR reverse GGATAACTAGTATTCTTAGC

RTS system (Sarah's, double RTS)
ClaI
7kb fragment
Ura4 sequence is used for the probe

rDNA

 

Electrophoresis

1st Dimension
Gel system (Bio-rad Sub Cell 15cmx25cm)
1. Melt agarose 0.35% (1.05g/300mL) in micro wave. There will be no EtBr in the first dimension. Do not over boil as the volume will alter.
2. A gel should be made in a cold room. Cool down the gel (otherwise it will deform the tray) and pour into the tray which is placed in a cold room. Use 20 lane comb. Wait for 30 minutes to become solid. Displace the comb very slowly (otherwise you will destroy or deform the well).
3. Pour 1.5L of 1x TBE in the gel tank (room temperature).
4. Place the gel tray slowly in the tank.
5. Load 1x dye on the lane to be used. (We use every other lane; lanes of the odd number, and final lane)
6. Wash the wells carefully and intensively by pasteur pipettes.
7. Samples should be mixed with 4mL of 20x Dye and centrifuged 13,000rpm for 1 minute. Load carefully into the wells. In the first lane load DNA size marker, and in the final lane, load 20mL of 20x Dye as a marker to monitor the run.
8. For the ARS2004, run should be 26hours at 50V. For RTS, 30hours at 50V. Bottom  Bromo-phenol Dye will be corresponding to 2.5kb in this concentration of the gel.
9 Stain the gel with 0.3mg/mL EtBr/TBE solution (15mL of 10mg/mL EtBr in 500mL 1x TBE) for 30 minutes at room temperature.
10. Cut gel as indicated in Figure.

2nd Dimension
1. 2nd Dimension should be started within same day. Cool down 3L of TBE for one gel and 5L for two gel for over night in a cold room. Gel apparatus (Owl Separation Systems, A5 Buffer Puffer) should be cooled down overnight as well. The initial  temperature of the tank and buffer affect a lot to the running time. The warmer the quicker.
2. Melt agarose during step 9 at 1st Dimension. 0.9% agarose. 3.15g/350mL.
3. Boil in microwave and add EtBr (10.5mL) and keep on the bench.
4. Align the strip of 1st dimension gels, and pour into tray slowly. Cool down to 50-60 degree as it can damage 1st dimension gels.
5. Wait for 30 minutes and run for 460minutes (ARS2004) or 580minutes (RTS). Running buffer will be 2L for one tank and 70mL of EtBr will be added.
6. If the run is not enough (ie; if the smallest DNA has not reached bottom yet), run longer.
7. Cut the gel into 10cm x 20cm and perform the southern blot.

.